https://jma.journal.ipb.ac.id/index.php/ipthp/issue/feed Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan 2022-06-01T07:32:52+07:00 Prof. Dr. agr. Asep Gunawan, S.Pt M.Sc agunawan.jipthp@gmail.com Open Journal Systems <p align="justify"><img src="/public/site/images/fapetipb/cover_iptp.jpg" alt="" width="178" height="211" align="left"></p> <p>&nbsp;</p> <p>Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan (Journal of Animal Production &amp; Processing Technology)<br><br>ISSN : <a href="https://portal.issn.org/api/search?search[]=MUST=notcanc,notinc,notissn,notissnl=%222303-2227%22&amp;search_id=2228944">2303-2227</a></p> <p>eISSN : <a href="https://portal.issn.org/api/search?search[]=MUST=notcanc,notinc,notissn,notissnl=%222303-2227%22&amp;search_id=2228944">2615-594X</a>&nbsp;<br><br>Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan is published three times a year in January, June, and October by Department of Animal Production and Technology, Faculty of Animal Science, IPB University in associated with <a href="https://drive.google.com/file/d/1bhEFBz8AGbtAQLiAsFH_Lyx_QN0L7LBm/view?usp=sharing">Animal Scientist's Society of Indonesia (HILPI)</a>. Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan as the open access journal has been indexed by <strong>Garuda, PKP Index, Indonesian Publication Index (IPI),</strong>&nbsp;<strong>EuroPub,</strong> <strong>Science and Technology Index (SINTA),&nbsp;</strong>and&nbsp;<strong>Google Scholar</strong>.</p> <p>Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan is currently an accredited journal under <strong>SINTA 3</strong> category by National Journal Accreditation (ARJUNA) under Ministry of Research, Technology, and Higher Education, Republic Indonesia as stipulated in the Decree No. 30.EKPT/2019.</p> <p>Jurnal Ilmu Produksi dan Teknologi Hasil Peternakan&nbsp;receives manuscripts encompass a broad range of research topics :&nbsp;livestock production, management and environment, breeding and genetics, livestock yield technology, and socio-economic livestock.</p> https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41109 Persepsi Peternak tentang Ayam IPB D-1 sebagai Ayam Lokal Unggul (Kasus Sinar Harapan Farm Jampang Tengah Sukabumi) 2022-06-01T07:32:52+07:00 L. Cyrilla luci.wanto@gmail.com C. Sumantri csumantri12@gmail.com <p><span class="fontstyle0">IPB D-1 chickens were produced from research on the application of molecular genetics with the aim of increasing the productivity and quality of Indonesian local chickens. This study aims to determine the perception of farmers at Sinar Harapan Farm Jampang Tengah Sukabumi about IPB D-1 chickens, which is viewed from the characteristics of innovations in IPB D-1 chickens. The research was conducted at Sinar Harapan Farm (SHF) which was located in Jampang Tengah District, Sukabumi Regency. Data collection was carried out in August 2020. Data collection was carried out by interviewing all 18 member farmers of Sinar Harapan Farm. SHF farmers’ perceptions of IPB D-1 chickens were measured from five characteristics of innovations in IPB D-1 chickens which included: relative advantage, compatibility, complexity, trialability, and observability. The results showed that the perception score for the aspect of relative advantage was 4.34, compatibility was 4.38, compatibility was 4.25, trialability was 4.13, and observability was 4.15. The farmers of Sinar Harapan Farm Jampang Tengah Sukabumi showed a good perception about IPB-D1 chickens.</span></p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41110 Effectiveness of Water Hyacinth Bioconversion and Fermented Fruit Waste as a Growing Media Larvae of Hermetia illucens 2022-06-01T07:32:49+07:00 Wahyuni wahyuni@unisla.ac.id R. C. Fadhlil wahyuni@unisla.ac.id <p><span class="fontstyle0">Black Soldier Fly (BSF) larvae have cellulosic activity in the presence of bacteria in their intestines. Generally, the organisms that play a role in bioconversion process are bacteria, and </span><span class="fontstyle2">Hermetia illucens </span><span class="fontstyle0">larvae as a bioconversion agent for fermented water hyacinth are combined with fruit waste and used as a growth medium. The purpose of this study was to determine the increase in larva mass weight, feed conversion efficiency, waste reduction index from water hyacinth bioconversion activity and fermented fruit waste by </span><span class="fontstyle2">Hermetia illucens </span><span class="fontstyle0">larvae. </span><span class="fontstyle2">Hermetia illucens </span><span class="fontstyle0">larvae are treated with feeding P0 = 100 % fruit waste, P1 = Fruit waste 25 % + 75 % fermented water hyacinth, P2 = 50 % fruit waste + 50 % fermented water hyacinth, and P3 = 75 % fruit waste + 25 % fermented water hyacinth. The larvae used were 6 days old, for all treatments 50 g used. The results showed that P3 = 75 % fruit waste + 25 % fermented water hyacinth produced the highest average final mass weight of larvae, namely 124.62 g, average feed consumption was 72.72 %, average ECD and WRI values were 10.98 % and 10.38 %, respectively. The mixing level of water hyacinth and fermented fruit waste in treatment 3 showed effective results as a medium for the growth of </span><span class="fontstyle2">Hermetia illucens </span><span class="fontstyle0">larvae.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41111 Review: Tepung Telur Ayam: Nilai Gizi, Sifat Fungsional dan Manfaat 2022-06-01T07:32:45+07:00 Z. Wulandari zakiahwu@apps.ipb.ac.id I. I. Arief isnafia@apps.ipb.ac.id <p><span class="fontstyle0">Eggs are an almost perfect source of animal protein. Commercial chicken eggs are a perfect food that contains nutrients such as protein (12.8 %) and fat (11.8 %). In 100 grams of whole eggs also contain vitamin A of 327.0 IU and minerals of 256.0 mg. Eggs contain high-quality protein because they have a complete composition of essential amino acids and have a high biological value, which is 100 %. The high content of water, fat and protein in eggs make this food as a good medium for bacterial growth so that their shelf life is quite short. Drying eggs into powder offers many advantages, including ease of storage, distribution, protection against microbial growth (low water activity), reduced weight per volume of whole eggs, longer shelf life. The use of egg powder as an additive to other food products is easier than using fresh eggs. The purpose of this review is to study the nutritional characteristics, functional properties and benefits of egg flour. The nutritional value and functional properties of egg powder, egg white powder and egg yolk powder can still provide maximum results both for raw material products or as food additives. The use of egg powder will facilitate industry, especially medium and large scale industries in handling, packaging, storage and processing compared to use with fresh eggs.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41112 Hubungan Tingkat Konsumsi Madu dengan Pengetahuan Gizi, Status Gizi, dan Kebugaran Remaja di Kota Bogor 2022-06-01T07:32:41+07:00 A. Septiani astariapriantini.ipb@gmail.com A. Apriantini astariapriantini.ipb@gmail.com T. Suryati tutisuryati16@gmail.com <p><span class="fontstyle0">Honey consumed regularly is known to improve vitality. The level of vitality can be influenced by several factors, such as the amount of food intake, that related to nutritional knowledge and status. The objectives of this study is to analyze the connection between the knowledge about nutrient, the status of nutrition, and the level of honey consumption to the vitality of adult’s body in Bogor City. Sampling is carried out based on the Slovin formula with a total of 100 respondents and has qualified representatives of adult’s in Bogor City. The status of nutrition measurement by anthropometric method. The data of body vitality level is measured through Balke Test. The data is collected through a questionnaire interview and then descriptively analyzed and tested for the correlation. The results that 69 % of the respondents are lack of knowledge about nutrient. The status of nutrition values is 79 % of them are normal. The highest level of honey consumption is 2 to 3 times a week. The conclusion is the knowledge about nutrient, the status of nutrition, and the level of honey consumption influence the vitality of human body based on the multiple correlation test.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41113 Karakteristik Produksi Cacing Tanah (Lumbricus rubellus) dengan Pakan Limbah Pasar Berupa Sayur Sawi Hijau dan Pepaya 2022-06-01T07:32:37+07:00 S. Liberty y-cahya@apps.ipb.ac.id Y. C. Endrawati y-cahya@apps.ipb.ac.id Salundik ndikipb@yahoo.co.id <p><span class="fontstyle0">Environmental pollution can be minimized by utilizing traditional market waste through the cultivation of earthworms. Market waste that is commonly found is vegetable and fruit waste. Market waste that is used as feed can minimize the production budget in worm farming. This research used a completely randomized method, four treatments and three replications. The aim of this study was to investigate the effect of feed with mustard green waste and papaya waste on the productivities (body weight and body length) of </span><span class="fontstyle2">Lumbricus rubellus</span><span class="fontstyle0">, vermicompost production, and that economic value. The results of the study stated that the treatment significantly (P&lt;0.05) affected the parameters of worm body weight, worm body length, and vermicompost production. Papaya waste (P</span><span class="fontstyle0" style="font-size: 6pt;">400</span><span class="fontstyle0">) treatment produce the highest body weight of </span><span class="fontstyle2">L. rubellus </span><span class="fontstyle0">in 1.108 ± 0.128 g, body length in 9.367 ± 0.446 cm, and waste degradation in 45.62 %. The papaya waste showed the highest results in terms of body weight gain and body length of </span><span class="fontstyle2">L. rubellus</span><span class="fontstyle0">. The cultivation of earthworm can provide economic value for Rp 514.428,60/4 months by producing earthworms and vermicompost.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41114 Tingkah Laku Makan Domba Lokal pada Sistem Pemeliharaan Berbeda 2022-06-01T07:32:34+07:00 I. Munandar imam.munandar@uts.ac.id M. Yamin mohamadyamin@yahoo.com D. A. Astuti dewiapriastuti86@gmail.com S. Rahayu srirahy19@gmail.com <p><span class="fontstyle0">Sheep is a livestock commodity this is used to meet national meat needs. This response takes a look at goals to look at social conduct and consume nearby sheep, which can be maintained in one of a kind renovation structures and supply one of a kind styles of concentrates. Looking at the 20 sheep used, their initial weight was 16.51 kg. Experiments were conducted throughout random layouts. The first part is device renovation and the second one part is the form of feed listen. The parameters discovered beating, mastication, remastication, regurgitation, length of eating. Data become analyzed with the aid of using evaluation of variance (ANOVA). The consequences of the take a look at confirmed that the form of listen and renovation device affected meals conduct (beating, mastication of remastication and regurgitation, length of eating).</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41115 Desain Primer Gen Virulensi invA untuk Identifikasi dan Sekuensing Salmonella pada Sampel Karkas Ayam 2022-06-01T07:32:30+07:00 R. P. Melati rahadinamelati@apps.ipb.ac.id S. Nurjanah sity_nr@apps.ipb.ac.id W. P. Rahayu wpr@apps.ipb.ac.id <p><span class="fontstyle0">Identification and sequencing of Salmonella require a specific primer as well as a virulence marker. Invasion gene (</span><span class="fontstyle2">invA</span><span class="fontstyle0">) is a gene found in all types of </span><span class="fontstyle2">Salmonella</span><span class="fontstyle0">, specific to </span><span class="fontstyle2">Salmonella</span><span class="fontstyle0">, and has a low mutation rate so that it can be used as a target gene for </span><span class="fontstyle2">Salmonella </span><span class="fontstyle0">identification. This study aimed to design a primer of </span><span class="fontstyle2">invA </span><span class="fontstyle0">gene of </span><span class="fontstyle2">Salmonella </span><span class="fontstyle0">spp. with long amplicons, has broad serovar coverage, and get an optimum PCR condition. Primers were designed and checked its specificity in silico using Primer-BLAST and then selected. Selected primer was evaluated for annealing temperature and primer concentration. Based on the sequential selection, it was obtained a set of </span><span class="fontstyle2">invA </span><span class="fontstyle0">gene primer with forwarding sequences GCCGGTGAAATTATCGCCAC (started at base 297) and reverses sequences CTCGTAATTCGCCGCCATTG (started at base 1763). Based on Primer-BLAST analysis, the primer gave an amplicon size of 1486 bp, has annealing temperature of 58 °C, capable of detecting at least 110 </span><span class="fontstyle2">Salmonella </span><span class="fontstyle0">serovars, capable to detect </span><span class="fontstyle2">Salmonella </span><span class="fontstyle0">contamination in chickens, and unable to detect the presence of </span><span class="fontstyle2">Klebsiella </span><span class="fontstyle0">sp</span><span class="fontstyle2">., Citrobacter </span><span class="fontstyle0">sp</span><span class="fontstyle2">., Serratia </span><span class="fontstyle0">sp</span><span class="fontstyle2">., Hafnia </span><span class="fontstyle0">sp</span><span class="fontstyle2">., </span><span class="fontstyle0">and </span><span class="fontstyle2">E. coli</span><span class="fontstyle0">. This primer can detect </span><span class="fontstyle2">Salmonella </span><span class="fontstyle0">very well with annealing temperature of 58 </span><sup><span class="fontstyle0">o</span></sup><span class="fontstyle0">C and primer concentration of 1.2 µM.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022 https://jma.journal.ipb.ac.id/index.php/ipthp/article/view/41116 Pengaruh Lama Waktu Penurunan Kadar Air terhadap Kualitas Fisikokimia Madu Kapuk dan Madu Rambutan 2022-06-01T07:32:27+07:00 A. Apriantini astariapriantini@yahoo.com Y. C. Endrawati y-cahya@apps.ipb.ac.id Z. Astarini y-cahya@apps.ipb.ac.id <p><span class="fontstyle0">Honey is a livestock product that has high nutritional content and beneficial for the health of human body, but Improper post-harvest handling can cause short shelf life. The aim of this study was to analyze the physicochemical quality of kapok honey and rambutan honey after moisture reduction treatment using a dehumidifier. The kapok and rambutan honey samples had three different duration of moisture reduction treatments, included 0 hours, 4 hours, and 8 hours at room temperature ±30 °C. Each treatment level was repeated four times. This study used descriptive analysis. The physicochemical analysis during the treatment consists of water content, pH, ash content, viscosity, color, and sugar content. The results showed that the treatment of honey for 8 hours at a temperature of ±30 °C had a water content that was close to the SNI standard. Moreover, the nutritional content of honey in the 8-hour treatment of moisture reduction had the best results in the physicochemical quality both of kapok honey and rambutan honey even though the treatment did not affect the ash content of rambutan honey and the pH value of the two types of honey. The moisture reduction did not reduce the physicochemical quality in 2 types of honey.</span> </p> 2022-06-01T00:00:00+07:00 Copyright (c) 2022